DOI: 10.14720/aas.2014.103.2.14
Agrovoc descriptors: valeriana officinalis, drug plants,growing media,roots,root hairs,nitrogen
Agris category code: f62
Impact of different culture media on hairy roots growth of Valeriana
officinalis L.
Ali PAKDIN PARIZI1*, Mohammad FARSI1, Ghorban-Ali NEMATZADEH2, Amin MIRSHAMSI1
Received April 09, 2013; accepted October 30, 2013. Delo je prispelo 09. aprila 2013, sprejeto 30. oktobra 2013.
ABSTRACT
Transformed hairy root cultures of Valeriana officinalis were established by infection with Agrobacterium rhizogenes strain ATCC 15834. To determine the effect of different media on the growth of V. officinalis hairy roots, MS, B5 media (1.0X and 0.5X strength), N6 medium and a modified MS medium without phytohormones were used. In addition, different NH4+ to NO3- ratios in MS medium were studied. The effects of these treatments were evaluated after 21 days of culture in relation to hairy root growth. B5 and V B5 media were the best basal media for hairy root growth. MS medium supplemented with a 20:20 ratio (mM) of NH4+ to NO3" displayed highest growth rates and biomass yield in hairy root cultures. The present study demonstrated that the composition of culture medium and the ratio of different nitrogen sources have significant impact on the growth of V. officinalis hairy roots.
Key words: Valeriana officinalis, hairy root, medium composition
IZVLEČEK
VPLIV RAZLIČNIH GOJITVENIH GOJIŠČ NA RAST TRANSFORMIRANIH KORENIN ZDRAVILNE ŠPAJKE (Valeriana officinalis L.)
Transformirana kultura korenin zdravilne špajke je bila vzpostavljena z bakterijsko okužbo Agrobacterium rhizogenes, sev ATCC 15834. Preučevana so bila različna gojišča MS, B5 (1,0X in 0,5X koncentracija), N6 in modificiran MS brez fitohormonov. Dodatno so bila v MS gojišču preučevana različna razmerja med NH4+ in NO3-. Učinki teh tretmajev na rast transformiranih korenin so bili ovrednoteni po 21 dneh. B5 in V B5 sta bili najboljši osnovni gojišči za rast transformiranih korenin. MS gojišče dopolnjeno z dušikovimi spojinami v razmerju 20:20 (mM) NH4+: NO3- je vplivalo na največjo rast in biomaso korenin. Raziskava je pokazala, da imata sestava rastnega gojišča in različna razmerja dušikovih spojin značilen vpliv na rast transformiranih korenin zdravilne špajke.
Ključne besede: Valeriana officinalis, transformirane korenine, sestava rastnega gojišča
1 INTRODUCTION
Valeriana officinalis L. (valerian) is a perennial herbaceous and rhizomatous medicinal plant native to Europe and Asia which has been naturalized in eastern North America and cultivated on a commercial scale in these regions (Cronquist, 1981). V. officinalis has been longley used as an important source of pharmaceutical compounds in traditional medicine (Straube, 1968; Morazzoni and Bombardelli, 1995; O'Hara et al., 1998) e.g.,
clinical trials have shown that valerian extract is effective in treatment of mild to moderate sleeping disorders and it can encourage sleep and improve sleep quality (Leathwood and Chauffard, 1985; Schulz et al., 1994). Furthermore, the valerian root is considered as mild anodyne, anticonvulsant, antispasmodic, carminative and hypotensive (Capasso and DeFeo, 1996; Hiller, 1996). Potential mechanisms for the pharmacological activity of
1	Ferdowsi University of Mashhad, Biotechnology Faculty, Agriculture Department, Mashhad, Iran, ali.pakdin@gmail.com
2	Genetics and agricultural Institute of Tabarestan, Sari, Mazandaran, Iran
valerian extracts may include increased release of y-aminobutyric acid (GABA) and agonistic activities on the GABA receptors (Marder et al., 2003).
Sesquiterpenes of the volatile oil (valerenic acid and its derivatives, valeranone, valeranal) and valepotriates (valtrate, didrovaltrate, acevaltrate, iso-valeroxyhydroxyvaltrate) are two main groups of compounds in the subterranean organs of valerian(Goppel, 2004). The valerenic acids have been reported for the sedative activity of V. officinalis and they are often used as an indicator of medicinal quality (Hendriks et al., 1981). The main representative of these compounds are valerenic acid (VA), acetoxyvalerenic acid and hydroxyvalerenic acid (Bos et al., 1996).
Genetically transformed hairy roots obtained by infection of plants with Agrobacterium rhizogenes are suitable source for production of bioactive molecules due to their genetic stability and generally show fast growth in culture media free of growth hormones (Shanks and Morgan, 1999). The hairy roots often exhibit about the same or greater
biosynthetic capacity for secondary metabolite production as compared to their parent plants, hence hairy roots have been used as an alternative and attractive method for the production of several plant metabolites (Zhou et al., 2011). Several attempts have also been made to enhance hairy root growth and their production of important bioactive compounds (Yu et al., 1996; Yu et al., 2006; Satdive et al., 2007; Shinde et al., 2009). Optimizing the composition of inorganic nutrients of the media for hairy root cultures is essential to gain high production of secondary metabolites (Condori et al., 2010; Shinde et al., 2010). It has been reported that concentration of nitrogen and appropriate ratio of nitrogen sources in the culture medium greatly affected the growth and production of secondary metabolites in hairy root cultures (Oksman-Caldentey et al., 1994; Yu et al., 1996; Lourenco et al., 2002).
In the present study, the effect of different basal media and various NH4+ to NO3- ratios in the culture medium on the growth of hairy root cultures of V. officinalis are discussed.
2 MATERIALS AND METHODS
2.1 Hairy root induction
Cotyledons of in vitro grown sterile V. officinalis L. plants were cut into pieces of approximately 1 cm in length. The explants were immersed in a suspension of A. rhizogenes strain ATCC 15834 containing 100 pM acetosyringone for 10 min and then blotted on sterile filter papers. All explants were then placed in petri dishes containing 25 ml of half strength solidified MS medium for co-cultivation. After 48 hours incubation in the dark at 28 °C, explants were transferred to fresh solidified /4 MS medium containing 500 mg l-1 cefotaxime and were subcultured at two week intervals to eliminate the bacteria. Tips of hairy roots were exsected and transferred to 50 ml, liquid / MS medium and were incubated at 25 °C on a rotary shaker at 110 rpm in darkness. Among several hairy root lines established, line No. 9 was selected for its vigorous and sustained growth and used for further experiments.
2.2 PCR analysis of hairy roots
Genomic DNA was extracted from the hairy roots of line No. 9 and from the roots of a non-transformed plant, to serve as a negative control, using the DNeasy Plant Mini kit (Qiagen, USA). Two 20-mer oligonucleotide primers, 5gctcttgcagtgctagattt3	(forward)	and
5gaaggtgcaagctacctctc3 (reverse), were used for PCR amplification of the rolB and rolC genes. In addition, primers 5atgtcgcaaggcagtaagccca3 (forward) and 5ggagtctttcagcatggagcaa3 (reverse), amplifying a fragment of virD2 gene were used for detecting bacterial contamination in hairy roots. The PCR reactions were carried out in a total 25 pl volume and consisted of 100 ng of genomic DNA, 10 pM each primers, 0.2 mM dNTP mix, 1 unit of Taq DNA polymerase and 2 mM MgCl2. PCR condition was as follows: 94 °C for 3 min (initial denaturation), 35 cycles of 94 °C for 45 s, 56 °C for 1 min and 72 C for 1 min and a final extension at 72 °C for 7 min. The PCR products were
separated by electrophoresing on a 1.2 % agarose adjusted to 5.8±0.2 prior to autoclaving and the gel in TBE buffer.	concentration of sucrose was 30 g l-1 for all media.
2.3 Media composition
Standard Gamborg's (B5), Murashige and Skoog's (MS) basal media, half strength medium of these media and N6 medium were used in the experiments. To determine the effects of different NH4+ to NO3- ratios on hairy root growth, conventional MS medium was modified in such a way that total NO3- and NH4+ ions were supplied from KNO3 and (NH4)2SO4 salts, respectively. Various combinations of this modified medium with different NH4+ to NO3" ratios (0:20, 10:20, 20:20, 20:10, 20:0 and 20:40 mM) were prepared. For investigating the effect of substituting NH4NO3 with (NH4)2SO4, the modified medium containing 20:40 ratio and its half strength were compared with conventional MS (half and full strength) in all experiments. The pH values of the media were
2.4	Growth measurement
Two hundred miligrams of hairy roots were added to 50 ml of each media as primary inoculum. After 21 days of cultivation at 25 °C at 110 rpm in darkness, hairy root clones were harvested to determine the fresh and dry weights. All experiments were replicated three times and four erlenmeyer flasks were used for each treatment.
2.5	Statistical analysis
In all of the experiments, the layout was totally randomized. Analyses were performed using SAS V. 9 software package (SAS Institute Inc., Cary, NC, USA.). For comparing different treatments, a one-way analysis of variance (ANOVA) and Duncan test with a critical value of P < 0.05 were applied.
3 RESULTS AND DISCUSSION
3.1 Establishment of hairy root clones
Hairy roots induced by A. rhizogenes provide an alternative system for the production of valuable bioactive compounds because of their genetic and biochemical stability (Zhou et al., 2011). In the present study, hairy roots were successfully induced by infection of cotyledon segments of V. officinalis with A. rhizogenes strain ATCC15834. Hairy roots emerged from the infected sites within
12-15 days with 30% transformation frequency and maintained on hormone free / MS medium. Among the hairy root clones, clone No. 9 was selected on the basis of its growth rate. The selected transformed clone showed rapid growth rate and tendency for profuse branching and active elongation, whilst untransformed roots did not show similar growth, elongation or branching pattern (Figure 1).
Figure 1: A) Hairy root formation on V. officinalis expiant after 7 days of inoculation. B) non-transformed root after 4 weeks culture in / MS medium. C) Hairy roots after 4 weeks culture in / MS medium.
3.2 Molecular analysis
PCRs were performed with specific primers to determine presence of T-DNA segment of Ri plasmid in the genomic DNA of V. officinalis hairy roots. The PCR with primers specific for rolB and rolC genes and template DNA from hairy roots amplified the expected bands of 450 and 700 bp, respectively (Figure 2) confirming the successful
integration of T-DNA, while DNA templates from untransformed roots (used as control) did not show any amplification. The PCR analysis of hairy root clones also revealed that no band was amplified for virD2 gene (Figure 2c), indicating absence of A. rhizogenes ATCC 15834 contamination in the cultures.
Figure 2: a) PCR amplification of rolB gene, lane 2: DNA from hairy roots; lane 3: A. rhizogenes DNA (positive control); lane 4: DNA from non-transformed root (negative control). b) PCR amplification of rolC gene, Lane 5: DNA from hairy root; lane 6: A. rhizogenes DNA; lane 7: DNA from non-transformed root. c) PCR amplification of virD gene, Lane 8: DNA from hairy root; lane 9: A. rhizogenes DNA; lane 10: DNA from non-transformed root. Lanes land 11: Molecular size marker (100 bp ladder, Fermentas Co., Germany).
3.3 Effect of basal medium on hairy root growth
Based on previous studies, media composition could have a significant impact on hairy root growth in culture systems (Yu et al., 1996; Lourenco et al., 2002; Sivakumar et al., 2005). In the present study, the growth rate of hairy root cultures in different media was measured after three weeks. B5 and '/2 B5 media produced the highest dry weight of hairy roots, 3.85 and 3.67 g l-1, respectively (Figure 3). Although, biomass production in B5 medium was higher than / B5 medium, this difference was not statistically significant. The N6 medium was the weakest medium for root growth of V. officinalis with just 0.86 g l-1 dry weight after 21 days. Both / MS and / MSV media had similar effects on the growth of hairy roots and this result was also observed for full concentration of these two media. These results indicated that substituting NH4NO3 with
(NH4)2SO4 in MSV medium had no significant effect on root growth. Furthermore, increased K+ ion concentration in the medium due to this replacement had not substantial alteration on the hairy root cultures. As shown in the figure 3, concentration of MS and MSV basal media influenced the biomass production. In both media higher dry weight values were obtained by roots grown in half strength MS and MSV media, 2.22 to 1.62 g l-1 and 2.658 to 2.01 g l-1, respectively. These results are in contrast with the results of Russowski et al. (2006) that studied the growth of whole plant in liquid culture and Chen et al. (2003) for taxol production in cell cultures of Taxus yunnanensis. High concentrations of inorganic nutrients in the full strength MS and MSV media may be the cause of these results. However, hairy roots dry weight in '/2 MS and MSV were not significantly different (Figure 3).
MS 1/2MS MSV 1/2MSV B5 Hairy root culture medium
1/2B5
N6
Figure 3: Effect of different culture media on hairy root growth of V. officinalis. Results are the mean of three replicates ± SD. Means with the same letter are not significantly different (p > 0.05).
3.4 Effect of NH4+ to NO3- ratio on hairy root growth
Different ratios of NH4+ to NO3- in MS medium were used for supplying the nitrogen requirement of the hairy roots. Figure 4 shows the effect of different nitrogen forms ratios on hairy root growth of V. officinalis. MS media supplemented with a 20:20 mM and 20:40 mM ratio of NH4+ to NO3-produced the maximum biomass after 21 days, 1.80 and 1.62 g l-1, respectively. MS medium with a 20:20 ratio of NH4+ to NO3- slightly had greater influence on the growth of hairy roots than basal MS medium (20:40 mM), but this difference was
not statistically significant. On the other hand, Shinde et al (2010) observed the highest biomass of Psoralea corylifolia hairy roots when MS medium was supplemented with NH4+ and NO3- at a ratio of 20:10. Decreasing the NH4+ concentration to 10 and 0 mM in the medium significantly reduced the hairy root growth. Similarly, decreasing the NO3- concentration had the same effect on the hairy root growth. Therefore, a balanced ratio of NH4+ to NO3- is an important factor for enhancing the growth of hairy root cultures in the V. officinalis.
Figure 4: Effect of NH4+ and NO3- ratio on hairy root growth of V. officinalis. Results are the mean of three replicates ± SD. Means with the same letter are not significantly different (p > 0.05).
4 CONCLUSION
The present study highlights the importance of optimizing the culture media composition for V. officinalis hairy roots. The growth of valerian hairy roots was greatly affected by the composition and
concentration of the culture media. The valerian hairy root system provides a promising platform that preserves the production of valuable sesquiterpenoids such as Valerenic acid.
5 REFERENCES
Bos R., Woerdenbag H.J., Hendriks H., Zwaving J.H., deSmet P.A.G.M., Tittel G. 1996. Analytical aspects of phytotherapeutic valerian preparations. Phytochemical Analysis, 7: 143-151. DOI: 10.1002/(SICI)1099-1565(199605)7:3<143::AID-PCA284>3.0.CO;2-1
Capasso A., DeFeo V., DeSimone F., Sorrentino L. 1996. Pharmacological effects of aqueous extract from Valeriana. Phytotherapy Research, 10: 30912. DOI: 10.1002/(SICI)1099-1573(199606)10:4<309::AID-PTR850>3.0.C0;2-J
Chen Y.-Q., Fei Y., Cai M., Lou J-X. 2003. Effects of amino acids, nitrate, and ammonium on the growth and taxol production in cell cultures of Taxus yunnanensis. Plant Growth Reg, 41: 265-268. DOI: 10.1023/B:GR0W.0000007502.72108.e3
Condori J., Sivakumar G., Hubstenberger J., Dolan M.D., Sobolev V.S., Medina-Bolivar F. 2010. Induced biosynthesis of resveratrol and the prenylated stilbenoids arachidin-1 and arachidin-3 in hairy root cultures of peanut: Effects of culture medium and growth stage. Plant Physiology and Biochemistry, 48 310-318. DOI: 10.1016/j.plaphy.2010.01.008
Cronquist A. 1981. An Integrated System of
Classification of Flowering Plants. New York, Columbia University Press. 1262 pp.
Goppel M., Franz G. 2004. Stability control of valerian ground material and extracts: a new HPLC-method for the routine quantification of valerenic acids and lignans. Pharmazie, 59: 446-452.
Hendriks H., Bos R., Allersma D.P., Malingre T.M., Koster A.S. 1981. Pharmacological screening of valerenal and some other components of essential oil of Valeriana officinalis. Planta Medica, 42: 6268. DOI: 10.1055/s-2007-971547
Hiller K. 1996. Neuropharmacological studies on ethanol extracts of Valeriana officinalis L: Behavioral and anticonvulsant properties. Phytother Res, 10: 145-51. DOI: 10.1002/(SICI)1099-1573(199603)10:2<145::AID-PTR793>3.0.CO;2-W
Leathwood P., Chauffard F. 1985. Aqueous extract of valerian reduces latency to fall asleep in man. Planta Medica, 54: 144-48. DOI: 10.1055/s-2007-969430
Lourenco P.M.L., Castro S.D., Martins T.M., Domingos A.C. 2002. Growth and proteolytic activity of hairy roots from Centaurea calcitrapa: effect of nitrogen and sucrose. Enzym Microb Technol, 31: 242-249. DOI: 10.1016/S0141-0229(02)00117-5
Marder M., Viola H., Wasowski C., Fernandez S.,
Medina J.H., Paladini A.C. 2003. 6-methylapigenin and hesperidin: new valeriana flavonoids with activity on the CNS. Pharmacol. Biochem. Behav, 75: 537-545. DOI: 10.1016/S0091-3057(03)00121-7
Morazzoni P., Bombardelli E. 1995. Valeriana
officinalis: traditional use and recent evaluations of activity. Fitoterapia, 66: 99-112.
O'Hara M., Kiefer D., Farrell K., Kemper K. 1998. A review of 12 commonly used medicinal herbs. Arch Fam Med, 7: 523-36. DOI: 10.1001/archfami.7.6.523
Oksman-Caldentey K., Sevon M., Vanhala L., Hiltunen R. 1994. Effect of nitrogen and sucrose on the primary and secondary metabolism of transformed root cultures of Hyoscyamus muticus. Plant Cell Tissue Organ Cult, 38: 263-272. DOI: 10.1007/BF00033886
Russowski D., Maurmann N., Beatriz Rech S., Germano Fett-Neto A. 2006. Role of light and medium composition on growth and valepotriate contents in Valeriana glechomifolia whole plant liquid cultures. Plant Cell Tiss Organ Cult, 86: 211-218. DOI: 10.1007/s11240-006-9109-z
Satdive R.K., Devanand P., Fulzele D.P., Eapen S.
2007. Enhanced production of azadirachtin by hairy root cultures of Azadirachta indica A. Juss by elicitation and media optimization. Journal of Biotechnology, 128: 281-289. DOI: 10.1016/j.jbiotec.2006.10.009
Schulz H., Stolz C., Muller J. 1994. The effect of valerian extract on sleep polygraphy in poor
sleepers: a pilot study. Pharmacopsychiatry, 27: 147-51. DOI: 10.1055/s-2007-1014295
Shanks J.V., Morgan M. 1999. Plant 'hairy root' culture. Current Opinion Biotechnology, 10: 151155. DOI: 10.1016/S0958-1669(99)80026-3
Shinde A.N., Malpathak N., Fulzele D.P. 2009. Enhanced Production of Phytoestrogenic Isoflavones from Hairy Root Cultures of Psoralea corylifolia L. Using Elicitation and Precursor Feeding Biotechnology and Bioprocess Engineering, 14: 288-294. DOI: 10.1007/s12257-008-0238-6
Shinde A.N., Malpathak N., Fulzele D.P. 2010. Impact of nutrient components on production of the phytoestrogens daidzein and genistein by hairy roots of Psoralea corylifolia. J Nat Med, 64: 346353. DOI: 10.1007/s11418-010-0419-4
Sivakumar G., Yu K.W., Paek K.Y. 2005. Production of biomass and ginsenoides from adventitious roots of Panax ginseng in bioreactor cultures. Eng Life Sci, 5: 333-342. DOI: 10.1002/elsc.200520085
Straube G. 1968. The importance of valerian roots in therapy. Ther Ggw, 107: 555-62.
Yu R.M., Ma N., Yan C.Y., Zhao Y. 2006. Effect of exogenous phytohormones on hairy root growth of polygonum multiflorum and biosynthesis of antraquionones in its hairy root cultures. Chin J Biotechnol, 22: 619-623. DOI: 10.1016/S1872-2075(06)60049-6
Yu S., Kwok K.H., Doran P.M. 1996. Effect of sucrose, exogenous product concentration, and other culture conditions on growth and steroidal alkaloid production by Solanum aviculare hairy roots. Enzym Microb Technol, 18: 238-243. DOI: 10.1016/0141-0229(95)00057-7
Zhou M.L., Zhu X.M., Shao J.R., Tang Y.X., Wu Y.M. 2011. Production and metabolic engineering of bioactive substances in plant hairy root culture. Appl Microbiol Biotechnol, 90: 1229-1239. DOI: 10.1007/s00253-011-3228-0